Description :
Non Conding Region
Location :
Scaffold_1:110057- 110268
Sequence
211 bases(100 bases per row)
TCTGTGTGTCTGTCTGCCACTCACTGCCTGCAAGTTGAGGCTCTTGAGCAGTGGCCACCAGTCAAACCAGTCCACATAAAATTAGTGTGTACACACTATA
GTACGGTGAAACAGAATATTGACACCTACGAAATAGAATATTGcatcttgaagcgacgcgTCTCTTCAATGGACGCTAAGAGTTGATAGAGCCTTGGGCT
GAGGTGAAGCA