Description :
Non Conding Region
Location :
Scaffold_1:110019- 110388
Sequence
369 bases(100 bases per row)
GATGCCTGCCCAAGATCCCTTTCTCCGCTGATCTGATTTCGTTGGGCTCTGGAACCTTCGCTACATGATTTTGACATATGCGTTATCAAGGGTTTAATGG
GCCACTTCTTGGAGTTTATCTCAAATTGAACAACCATGGTGAGGTGGGTAGATTGGCGGAAGCTGCCGCTCTCTCGGACCTCATGGGGTCCGCTCTAGGA
GGCTGACCATGATATGACCATGTACTTATATATGTAGCGCCGCCGCTGTGATGAACCGCGTGCCGCGCGACAAGCTGCCGCAGGTGCTGAGCCACGTTCT
CGAGAAGCGCGCGTCGGCGGTAGCGAGATCCTGTTTGGCTCGTTGGAAATGAGGACCTTGCTAATGTTT