Description :
Non Conding Region
Location :
Scaffold_1:10993- 12263
Sequence
1270 bases(100 bases per row)
TTGGTTGGTGTGGTGGAGGGGAAATTGAGTTGTGGCCATTTGGCGGAGCTGCAATGGTGCTGTCGAGGCCGTTCCTCATCAACCGACCTTGACGCCCACC
TTGCGGCTTTGAGCGCGCTTCTATGCGGCCGCAGGCGTTGCCAACCCGTCCATCCTAATGCAACCTCACGGATGTGGAGTGGATGTGGACACTACTTTGG
AGGCAAAGTTGTGTACGGACTAATAGAGCTGCAGCTTCGTCCATTGCTCGAGGATCGAGTAGGTGTTGCTACATCCAGCACAGCATTTCAGAGAACCTGG
GAGCTGCATGCTCTCGGGTGTTGACACCATTCAGTGCTTCGGATGCAATTCGGTCGGGAACACATGAAGCTGGCGGATCATTTTGAAGTTGGTCCTTGCT
GGAGGCCCAGGGTCATTTCAATTTCTCCAGCAGGCGTTATGTGTATGTCTGTTTGCGGCTTTTGATTGGTCGACTGTTGGCCCAATTGTGGCAGATGACA
GGCCAATCAGAAGAGCGCATTTTGGATCGTATTGGCCACGAAAGTGACAAAACGGAATGGAGACTTGATGGGGTCTCGCACCGTGCGGCTAAGAGCATCC
CCATCGCTGTTTCGTTGATGGAGACGTTCGAGCTTGGTGTTCACGGGCTGACATGTGTGCGGTACGTTCAAGGCTTTGGCCCTTGCTCAGCTGCAACTCA
GTGTTTCCACAAACAGTTGGACTCATGGGATCGACAGACGCGCACTGCAGCAGGATGCGCCTGTAGTTTCGCCAGCAGAAACTGCCTCTGCTGGTCGCTG
ATTCCGCGCTGGTCACAAGTAGATCACCGGAACAAAATTTATGAAATGTGTCTCGCTGATGTTGACCGTAAGTTTTTGGTAGTCGGGTCTCTGCAAATAT
CCTCTCTAATCGGATATTGTGCAAGATATTGTGACAGTCCACATTGGTAACTGAATGGTGTTAATTGCATCGAATAGCATTAATTCAGTAGGCACAAAAT
ATGCTAGCTTTGCTCGTCATGGCAAAGCTGACTGGACCGGCACGCATTCGGGAGAAAAGAAAAGGCAACTCAGCTCATCAATCTGCACAGGACAGAGCTC
GAAAGCCTTGCTCAGCTAGAGCCTCGCCTTCTCGAGGCGCGATGCTACGCGCTACTACCGCGCAAGCTCGCTGTGCAGTCGTTGCAGATCGCTCGCTGCT
GTCGTCTGGAGACTACCTTCCCGCGCCGAGCCGCATTGTCATTCCTGCATTTGCGCTCAAGCACGCACGA