Description :
Non Conding Region
Location :
Scaffold_1:109768- 112581
Sequence
2813 bases(100 bases per row)
CTTCAAAAAATGTCTGGCAGGCAACCACCACCTCGGAGTCTCCTATCCGGCACGACGATTTGTCCGGATAATGAATTTTGCAATTGTACTTACAGTGGTC
AATTGCTCGACCGACCGTCCGGATAGTTCATCATATTCCAGGGGTGTGTTTGCTCTTCCAATGTATATTTTTCATTTTGAAAACTATTCACTATTTCATT
GCCGACGCACTATCGGTACCATTTTCGACTTTGCTCTCCGCGGAGTACGCGGTTCCAGCAGCTTAATCCGCTCCGTCGACGGAGTCCAGGTGCGCTGTCG
TGCCCACTCCTTTGGCCACGTCGCAATCCCAACTTTTACAAGGAATTTCTGCTCTAGTCGATAAACGCATCATATCTTTTGCAGTCACTCGTGTGCGAGT
TGGTCTAATCTCACGAACAATTGTTTGAAAAATTTCGTGTTCGCTCACAATCGATGCAACTTGTATCCTAGTAACCCAGACATGTTAGGCTGTTTTGGAG
AATGAAGAATGAATAGGCTTGCGGCCATGAACCCAAAATCCTACAACAGACCAATGAAGTTGAAGGATGTAATGTCAGAAGTAAAATATAATCACTCTCC
AGGTTATTAAGACACTAGAAACAAATAGAATCTAGAGAGTATTTTATCAACCGTCAAGGACTATAAATATTTAGGATGCTAATTGACCAGCACTCTTAAC
TTTGATTGACCATTTCATAAAGCGTATTGCGTTTGAAGGAATGAGCATAAATACATTGTATTCGGAAGAATACGTTGACTGTGAGTAGGAGAACAATCTT
TAATAAAATTCATGCACAAACTCTCAAACTGCAAAAAATGTCGGTCGATGCGCTCGTTCACTGCTTTTACTACCTCATTTTTGTATCGATTGCTAGCGGG
ACGAGATGGACGGTTTCCAGACTCTGATTGGCAAAATAAATTAGTATGTCGTGTTCCTTGCAATAAGCTGAATCGACTGGCAGTGTTCTTGTGAATTGCA
TTATTAATTTTCGTTTGAAACCGTCTATGCCAAATCCAATACAAAAACCGAGCCAAGTTTGACGGACGAGCAAACGGTGCCGCTATACCAACACCTCATC
AAGGTCAGCGTGGACGGCCAACTTACCCGCGAAAATGTTCATACTGTGTGCAACACGTATGACGCCTAACGCTTAACGGGTTGCGTACTTACAAGCGTGG
TGACGACACCAAGTCGTTGAATGGTGTGGCGAACGTCACGTCGTGTTTACAGTGCGTCACCGGCAGATGCACCAAGTATGAGCCATAAGAAATCGAGCAG
CGAATCAAGAGCGTACCGTTGCACAAGCACCAAACGTACCGATCTCTAGCTGCGGCGACTGGTGTCTCTGCGTTCGTCCTGTGGACATTAGTCAAGAAGA
AATGGATGGCAAGATGGTCAAGTTGGACAATGCCGCACCTTACTGCCGAACAGACGTTGGACCTCCACAACATTTTGTGCCAAATCCCGCTGAATGCACT
AGATGGCCATTTCAAAGACATGGCCAATGTGGTGCATTTGGACGAGAAATGGTTTTGCTTTACCAAGCTCCGTTGTCGCTTCCTTTGGTACGACGAAACC
ATCTTGCCTTGGTATATCTAGTCCAAGTCACACATCATCAAGGTGAAGTATTTGGTTGCCGCCGCTGGGCCGCCGCCAAGATGGGACGGTAAGGTTGGCT
GCTGCAAAATTATGAAGCGAATGACTGCCAGCCGAAGCAACGTCAACAGGACGGCCGGAGCGGAGGTGGTGCGGAGCATCACTGTGACGCGCGATGTTTA
CCACCGGCTACTTAGCGACAATATGCGATCAAGGAAATACGGCCAACGGCAAATGCAAGAGCTTACCTGCAACAAGACAACGCGTCCCTCATATTTCGCC
CGAAGATGCTACACTTGCTGCTACCGCGATTCTGGTGGCTGAGACATTCGAAAGTGGAATTAACCATCAAGGTCCCTGGATCCAAGCGATTATACTTTGG
GTTTTTAACTCTTTCAAGCTATGTAACAATCTGTGGAGTGTCAGACGATGCCACGATGAAGACTGCGTTCGATCAGCTGGTGCCGTCGACGCTGGAGAAG
TCATTCTCTACCTTGTGTCGTGTTATGAACATTGTCATTGAATGCGGAGTTGACAATAGGTCTAAACTCCCTCGCAGTACATTGAGCTATGAGGGTGAGT
TAGCATTAGAAATGATGAGCTTGAGGCTTAAGAAAGTGCAAACTTTAGAAGATATTGCAGATTTGTTGTGCCACTGGAGGATGAACGATTACTCTATTTT
ACTTAGATTCTGTTTCTAAATCTTCCTATACTATTGAACTTTTGCTCGCAATTGTTCAAAAGCAGACGTAGTAATAGCTATTTTGCGCTTTCTGAGGATT
CCGACGAAATCTGATAAAAAATACTCCATGCCAATCAAAGGCACGTGAAATGTATCACATGCTATGAGCTGCAACTGCTCATCAATCGGATTGCTGATGG
ACACTTCCACTAGATAGCGACGGAAATCATGAAAAACCGATGTGTCGATGTATGCGTCGAATCAAACGATCAGCGCATGAACCATTCTTGATTGGCAGGA
ACAACATGACCTCGTCGAATCGAATCACGATGGGCAGTTGCGCCAATTGGCTAACAGTCCACGAGGGCATCGAGGGGCCAAGGCCAATTTCTAAAATCAA
TAATACATTTGCACAAGCAAAATAATAATGCTTGAACTGACTGGACCTCTACAATTGCATTCAACTTGAAATATTGAATTACACAAGAAATTAAACACAA
GAAGCCGCGATGC