Description :
Non Conding Region
Location :
scaffold_1:109753- 110133
Sequence
380 bases(100 bases per row)
GAGCAATTGAACCTAAGTAATATTCTCGTTGATTCTTCTCGTCGGATGAACTTGTACTTCATTTTAATGAGTACTGTTGTGAATTACTGGTCCTCACCGG
TTGCTACTGTTGCAGTTTAGCTTTTGTCTTACAGCAAGTTGAAGTGTAGATACACAAAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGG
GAAAACCACACAACAGAAAATACAACGGGAGCAGCACGTCGCTTTACTCCCTCGCCCCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTG
CTGACGCACGCAAAAGCAGCCAAGTTACAAGTGGTTATGAGCCCAAGGCTGGGTTGGTAACTCCCCGACGGTGAAGATCA