Description :
Non Conding Region
Location :
contig_1:109427- 109699
Sequence
272 bases(100 bases per row)
GTCTCCAATACAAAAAGTTGGTTTTGGTCCAATCATGCAATGTGAATGACGTACCCTGTTGCAAGTCGAATGTCTAACATTAAGTTTACCACCGTAAAAG
GAACCCATGAGCTCGTGCAGATAAGGTCGTGCACTGGTAATGGTGCCGCTAAAAATGCAAGCAGAGCTCAAAGCGTGACTAGCAATGGATATTTCTGTCG
AGGTGAAGAGGGCATTTGAGATCTGAACGAGTTCCGCACAAGCGAATAGCTTTGTCCGCAACAGTGAAAGCA