Description :
Non Conding Region
Location :
Scaffold_1:109416- 109850
Sequence
434 bases(100 bases per row)
GTGAATTCGCACACATGAGACAGAGAACCCGACGCTGCGGCTGCCACGTCATAAGGTATCAAGTTTGACAATGTATGTATTTTGAGAGGACAAAAGATCG
CCACGCGCGACCAGGTTGAAGAAGGTCCATCATGCGTTCTGAGAGAATCACCAGTGCCACAATCGGCTGCGACGAGGCCACGGTCGCACTGGCTTGACGA
CGTACTATCTAAGGCAATCGGTGGCCCTTCAACTCTTTTCTTATTGCGCTGAGCGGCGGTGCTGATGGGGTTGACGAGGCTGTCAGTTCACACATGTGAT
TCTCGTCGGCAGGTTCGTAGCTCGAGTAGCGACGAGTCACCGGTTTTGTGTCGACGACAACCGAGCGAATCAACTACTAGTATTGGTTACAGTGGTGAAC
TACTACAGTGTGACTAGACGATCGAGGACTTGGC