Description :
Non Conding Region
Location :
Scaffold_1:109368- 109521
Sequence
153 bases(100 bases per row)
CACTGCAGCCAAGCTTCATGCTCATAACTAGTGCACAAAATACGCTTGTTACGGTACTTCAAACTATGTCGTTTTGATACTTTTATTTCGTGTATCGCAC
CTCATTTTTACAAAAACTTAACTTCGGTCAATCCACATTTTGTCAACCGAATA