Description :
Non Conding Region
Location :
Scaffold_1:109359- 112568
Sequence
3209 bases(100 bases per row)
AGATTCCGACTTTAGAGCGCACATACACGATGCCCACGGTGAACTGAAGCTGGATGTAACCAATGTATGTAACGATCTGTTCGTGATGGCGTAGTTCGCG
CTAGGGGAGATTGTGGACCCACGTCGAAAGTGAGGGGGGCATCATATCGACTCCCATCCAAGCCATCTATAAACGGCCGCTCTGTAGAAGCCAAACTTCT
TTTCACCGTAGGATCAATTGGAGATATCCTGTGATACATCTCTCGAACGTGTGTGCGTATCGATCGCGTGTCGTGGAGTTTGGGTGAAGTCATTTTGTTG
CGTTTGGCTGTTTGAATCATCCCGAGATCGCTAAAAAGCCGCTCCGTGGTTGCAGTATTCACTACAACCAAGAGAATCGTAATTGCGAGTTTAGGAAGTC
GACTATTTGGAACCTGTTTCGCGACGTGTTTCCAGTATTCTTCATACGAATTGTCGAGCCCCGTAATACGTGCGGATGTCAGTCGACCTTCAATGCATTT
GTCCATCTCGCTTCGGACACAACCGTAATCCTCATCAATTAGCCGACGGTAGTAGTACACGGCAAACTTGCCGAGTTGGGTGGGTGAAGAAATGGGAGCA
TTTTCAGCACCATTCGTGACCAATTCGAGTGCTTGTGGTACAAGAACAGGATTCAACACAAATGCCAACATAAACAAAGGCTGTTCACACTGTTTCCATC
GCTTCTCAACACACCTAACTAACGACATCCGACAGGCATCATCGTCCTGATACTCGTTAAATCCACGAAATATATCACCAAATGAGACCACAACATCACC
TAAAGTATTCTCATCTCGTTGAAGTCGATATGACGCCGCTGATAATGGGGAAATAATATTTTCCGCTATTGATAACTTTCCCCAGAATGAGCCATCCGAC
AATTTTTTTAACGTGTCTGGCAAATCTTTTTGAAGGCGATATTTATTCGCGAACATTTCTAGACAAGTGCGAACTCGAAGAAGCGAAGCAAAACAGTATT
GCATACTGTTCCATCGAGTCTCACACAGGGTAAACAGAGCCAGTGGTTTACAGTAGCACTCCTTCATCAGTACCGCAGCACGAGGAAGCCACGTCGCCGA
AGATGCGTTTAGGCATTTTACCACGGCTGTTGCCTGCTTCGCCACTGAAGAAAATGACGATCGCAACACCTCCTGAACTAGATTGTTAATATCATGAGCA
AAGCAAAAAGAAAGGTAACACGGAACCAACGCTTCGCTAAAATTCGGCGCGCTCTTCCACACTGACCATCATTGTCGGTAACTAGGGCTCCAATTATCCA
ACCTTCCTGAGTAGCCTGTTTCAGAAGACCCTCCATTTCATCCGCCATCGTGGCAAGAACCTCCTTTGGGGAGTGCGTAGGTAAGGGTACGACCCGAAAG
CGCCAGTTGAAATCCCAAAACATGCTCTCTCGAAATATTTTGCCAAACGTCCGCGAGTGCCTTTACACGCCCACCACTGGAATTCTGTTTTTCTTTCAAT
TTTTTTGTCTCGATTTTCTTGCAGTGGGCAGCGTGCGCCTTGCGAATACGTCCACCCAGAATTCGGCGAGACGGTAGATAAGCTGTTATTCCAGGGCAGA
GGTATTCCAGCAGTGCTCTTGTCGATTCTCGTTCGATGAATAGGTCAGCCAGGACGTTATCAGATTGAAATTGAATTAAAAGTCGCTCCAGTTCGCCTTT
TTGCTGCTTCGTAAAACGTGTAGGGGTTATTGATCGCTTGCGCCGAGGCGATTTCTTTGCTGATGTGAACAGGCGAGTGGTGACAGTTCGCTTTCGCTGT
GGGGGGCCTACACTTGAGTCCGTGTCCTTCTGGGCTTCGAATCTGGAGCTTATCACAGTAGCTTGATAGTACTGACATACCTTCAAGTGACCAGTGTAGC
TATAGGCATGCCCTAACACCGGAACAGGGCCATCAATATCGGGGTCTTTTGAAAACGCCAAAGAGCAGTGGTCGCACGTAGCCACCATTACTTTTTGGGA
TATGATCCGACCTCGTAAAGTGATTCTTCTCCGGGACATGAGGTCGAACCATCTTCACAGGTTGCACACTAGCAAATGAACGAAATGATCTTAGACAGCT
GCGCCTTCGACAACAGTGAATCAGACAAGATAGAGGCGCGTATCGGAGGGGCAGATACGGTGACCCAGACAGGAGAAGGCCGGACAACAGCAACGCGAAT
ATTATGCGGCAGCAAGCTTTGTCGACACGTGTTGTAGCTGTTTGTACGAAGACTCAGATTTATTTCATTTGGATATTTGTATACCATATAATACACGAGT
GAAACTCAAAAGGCGCCTTTACTATAAGACGAATAGTCCGCTCTTTCACCTAAACTGTGATTGGGCGCCTTTTCGAAAGGCGGTAAAGGCACCCGTTGCC
ATCGCTGCTGGGACTGCCGCAAGAGCCGCCGCATAGCCCTGGCCATTCCCTCTTTTTCTCTCATCTAGCACAAGTGCCCCGTAACAACCCAGTGCATTTG
CTTTGGGTTCACTGCATGTTTGTATACCAGCCACCTCTGCTGTCAATGCAAAGCCTGCTGACTCTGATTCGAGGTTTACATTGCTGTTCCGCAAGGAGGT
TAAGCTTTGTGTTTGATGCTGCGCTTAGATGTGTGTTTGATTGCTCTGTAACAAGGTTAACTTGCTGTTCCAATTGGAGGTTAAGCTTAGGGTTCAATGT
AGAGCTATCAATGTCTATCCCCTGCTACTGATTTTAAGGCACGTAATACACCCTGTATTAACTCCTTATGCTCTACATCGTCTATCCTTCCGTTGTGTTG
ATCGTGTTGTCCTCAACAGCTGCCTCTTAGATGAACTTCTTTCGAACAAGAAGGCGGCGCTCTTTTTTGAAGGCAGCGACGACAGTCTGGCTCAGGTGTT
CTCGAGGCTTCACTAACCCGGATGTTGTACGCCTTGCGAGCAGCGATGCATAGCGTCTTGAACGCCTTCGCGGAGCTGATGTCGTTCTTCTTGGGCTTGA
TTGAAGGCGTGGCGGATGCTTCGCTGGTTCGGGTGCAGAACGGAGAGTGAGCATCAGCGTTCTACAGGCGATAATCATGAACAGCAACGACTGGTTGCGG
CGACAAAAGGTAAGTCTGTACGCAACTACGTGCTTAAACTAAACCTAGTATGTTGGTGGTGTGCGAAGAAGCAGGGTCAACTACGTGGCCGGCGGCTTGA
AGTTGCTTC