Description :
Non Conding Region
Location :
Scaffold_1:109218- 109469
Sequence
251 bases(100 bases per row)
CTCTCCCTCCTTATCATTGCTCCCCTCAATGCTGCGTGTCATTGCCATTTTCGAGCGGTTATCAGATGGAGAATGTAGCCATGTGCTGTTTTTATCCACT
CACCTGTTTGTGTGTCCTGTTTACGCCAATCAGTAAAAGATCGCGCGACATCATTTCGGCCAATCCGAGCCCCTCCCGCGCGCCAGCGGGTCGCCCGTGG
AACACAAGCGAACAGCGCCGAAGTCGGCCAAGCGAACACGAGCGAACGCAA