Description :
Non Conding Region
Location :
Scaffold_1:109155- 109208
Sequence
53 bases(100 bases per row)
GTCTAAATGGAAATTGTGCCTTCTGCTGTACACTGAACAACAGTGTATGTGGA