Description :
Non Conding Region
Location :
Scaffold_1:109135- 109335
Sequence
200 bases(100 bases per row)
AGCGGCTCCAGTTCCATGATGCGTTCCTGTGATGCAGCTGCTTGGCGTTCATCATGTAAACCGGACAGGCAGCTCGCTCCATTCAGTGGAAGCATTGAGA
ACGCCGTGAGTGCTTCCAAGCCCACGCTGAATTAACACGCCTTTGAACAGCACGAGCGATATCTTATATTATTGACATTGACTAGTACAAGGTGAAGGCT