Description :
Non Conding Region
Location :
Scaffold_1:109117- 109345
Sequence
228 bases(100 bases per row)
TTGGCTCGACAAGTTGAAAATGGTGCAATGATTACAGTACTGTAGGACAAATGATGTGACGCACATAATCGATTAGCAATGGCTACAGTTGGAGGACAAT
GTTGAAGGACGCAATTTTTGTTTGAACTACCGTTTGATTGAAGGTAATACCAACTCCATTATACATACAGAAAAAACTCCTAGAGCTGGTGGCTTCCTAG
CACTCGGAAGCGTTGGCCGAGAGGCCCT