Description :
Non Conding Region
Location :
Scaffold_1:108952- 109143
Sequence
191 bases(100 bases per row)
TCGGTGGAGCGAGGAGGGGGCTCTATTGAGAAGTGACAATCACTCAGCAGCACCGCACGCAACACGTGTGCACCACAATTATTGTGTACCACACACCACA
CATGAAGCCGAGATGGCTAGATGTCACAACTAACTCGCTTCCCTCCAGCACTTACGTAGCAACGCAGCCTTCCTCTCGTCTATTACAGCTA