Description :
Non Conding Region
Location :
Scaffold_1:108624- 110094
Sequence
1470 bases(100 bases per row)
TACCGTAGGGCCCGGATTAACCGCGCCAGTGGGACAAACTGGGTTTAGCCCAGAGTGGGCAATTGATGGCCACCGTCTTTCTATGCGGCGTTGCCCAGTC
ACATGCGCCCTCGTTCGACACGAAGCGCCATCGCGAGCGCATCCGAAAAGCTCTGCGAGCGCTTGCGCCGGTGCCTGCTAGGCATTGTAGCCACACGTAT
CTTCTACCCAGCTTTCTCGCTCGTCAAAGGCGGAATCTGCAGCTTTCAAATGGGACGAGGAGTGTGGGCCGTTCTGGCTGCGAACGCGAACGCGGTATGA
ACGTGGCGTTGAGTGGATGTCGCCGACGCGGCTGCGGCAAGGCGACTCGAGTCTTTTTGTCGCGCGAGATCCTACACTCGAACGTGCGGCGCCGTCCGAT
TGCAAGATATTACGGCAACGCATCTATCAACCGGGTGGAAAACCTCGGTGGTCGAATAACCCAGGGGCAAATCCCGTTTACGGGACAAACTCCATGGAAA
AGCCCAGCTTCAACAACTTGAGTGGTCAAGCTACTCTTTTAACCCGTTTCGGAGTTCTGTGCCACTCCCTTGGATCAGCAGTAGCCTGCTGCTATTCCCA
CATCTATAACGCATGTACCTTCTTACTGAGGGAAACACTCGGTTTATTCTCCCCAAAACAACGTTTGCACTCTTGCAATGCTACTGATTTGAGGAGAATT
TAACGAGATCCGACTTTTTATTTATCGCACTATGTGAATATTGATTGTGACACGAGCCGTCCATAAAACCCTCGCGAGTCGCGTCCATGACGCGCCGCAA
CCGCCGAGGCGACTCGCGACGGCAAGGCTAACGAAACGCAACATACTGCTCTTTGTATGCAGTCCCATCCCCGGCCGCGGGGTGGCCAGCGCCAGCGGAG
ATGTCCTGCGATATGTGGCACCTGCCAGCACGCGATCGGCGGCGCCTCGTCCCGCGCCCCTGGGAAAAAAGTTGCGTGGAATTAGCGCCTACGTGGCACG
ACGTACCCAACGGATTTGAGTGGGATCCTTGACAGCTTGTCTTTGGCCAGTTGAGAGACGGCTATTACATGCCTGCATTGCCTCGCAGCATGCGAGGTTA
ATGCCAAGCGGGTTGGTTGTTGCACACCAAAATTTAGACTCGAGTGGGATCTCGTCTTCTCTCTTTACTGACGTGACAAGCTCGCGCGCCGAATAGAAGC
GTCGTGGTCGTCTCGTCAAGCAGCGAGCTCATGGTAGCGAGCTTGCATTTGTGGAGTGGCTTTTCTACCATAGTAGCTGGTACACCAACCACGCTAAAAG
GTCGCACGCCGTGTCACGGACGACCTCACACACACGCACTCAAGCCACGTGCTGCGATGACGCAGCCGCCGTGCAGTAGCTGCACACTACTTACTTGATA
GAGGCAAGGCCATCGCAAGGCGATGTCGCGGGAACTCGAGCGTTCGAGACAGAAGGCTAAAAATACATTG