Description :
Non Conding Region
Location :
scaffold_1:108585- 108855
Sequence
270 bases(100 bases per row)
ACGCCGCAATTGTAGCCCTCGCCCTGGTCCGCCGGTTATAATTTTCTGTTTCTTCCTCCCCAATGTTGTAAAATTTATCCCAATTAGATACGATTGGAAC
ACTGTACCACACGTCGGAGATGAAGCCATTTCCATCTTGACCGACTGAAGCGGTATGACCACAATTCCCTGTTTGATTCCTAAGCTTGCTGCACGTGCCG
TCCAGCTTGTTTCCTACCACGCGACTGACTCACTAGCTCGCCACTGCTTCGTGCACTCAATGTCGGCACT