Description :
Non Conding Region
Location :
Scaffold_1:108576- 108966
Sequence
390 bases(100 bases per row)
GCTTGGGCCCGCTCGAAGGAAACGCTGATCTTGGAGGGTGGCGTGGAGCTCGGTATTTGCGGGACTGAGTGCATTGTGTGGAAAGCGGGAGCTCTCGCGG
GGCAATTCGCGCGGCAGGAGCCCTGAGTTCGCGCCAAAATGACTGGTGCGAGGGAGTTTGCAGTTTGCCTGAAAAGTGTACCCATCCATTTTGCAAAACA
TGAAAAATGCACCAATTTTGTTCACTTGAAGTGACCCAGGTTTTATCACTGCAGCTTGGTTTGTAAAACTTGCAAGTAGGGTGGGAAATGGTGTAGTTTG
TCGTCGTGCTCGGCGTGGTATGCGTCGGAGTAATCACTCTCCTCCAGTCTGCTATCACTGCCGTACTGATCCTGTGCGTGGACCTCTTCA