Description :
Non Conding Region
Location :
contig_1:108378- 108481
Sequence
103 bases(100 bases per row)
GGTGGGTGCTCATTTTCAGGTTGGAGGGGGAAATGCTGCTGCTTTTCAAATAGATTTCAATGATTCTTGCTCTTGGACAACTGACAGACGTTTATTGACG
GAT