Description :
Non Conding Region
Location :
Scaffold_1:108134- 109606
Sequence
1472 bases(100 bases per row)
CACGAAAACAATGAGGCAGCGGCATCACCTTGCGCATACAGATGACGTGCTGTGCGTTTGCTTGCATCCAAAGCTTCCGCTTGCAGCGAGTGGGGAAATA
GGAAGACAACCGATGCTGATTGTGTGGGATCTGGTATCGACCGAGTCCAAATGCATTTTGCAAGGCTTTCACCAGCGCGGCATCATGCAGATCGCGTTCC
AGACGGAAGAACTTTTGGTCTCAATCGGCGGCGACGATGTCCATAGTGTCGGTATCTACGAGTCCAAGGATGCGTGGAAATCCGCGACGCTAAAAATCTT
CGCCAAGGGGAACAAAGCCGTTCCCTTTCATCTGGCGACGAAGCCTGCGTCTGCAAACGAGTTTGTTGTGTGTGGGCAAAAATACGTCGAGTTTTGGACG
ATCGAGGCCAAGTCGGTCATCAGCAAAAAAGCGCTGCTTGGGAAGAAAGGCACACTGCAGCCTTTTTTGGTGGCCGAGTACCTTAAAGACACATCATTGA
CTGTTGTTGGAACTAATGATGGGCATCTCTATCTCTTTAACGGGCGAGATTTGTCGAGCGTCGTGAAAGCGCATAATGGACCAGTAAATGCGCTGCACTT
TGCAACTGGCGCGCTTCTCTCTGGTGGCAAAGATGGCCAAATCTTTATTTGGGACGATAAATTGAAACAAATCGGCGGACCGTTCTGCCTTGCTGACTCG
GTGCTGCCATCCGTGATGCAGCCACAGTTCGTCTCTGTGCGCAGCTGCTGTTTTTCTCCGAATCGGAAAACGATCCTCCTTGGAACTCAGGCATCGGAGA
TTTATGAGATTGATGCAACAAATGGCCAGAACATTCGATCAGATGCGTTGATGCGAGGGCATTTCCATGGTGAGCTGTGGGGTTTAGACGTCCATCCACA
CAAGCAGCAATGCTGCACAGTTGGCGATGACCAGATGCTGCGAATCTGGGATCTCGACACAAAGAAGGAACTTCGAAGTGTGCGTTTGGATGGCCCAGGT
CGAGCGTGCGCGTACTCGAGTGATGGGAAACTCGTTGCAGTGGGGCTTGGCACTGACGGAATAGGCACAACAGGAGTCAACACGAAAGGTTCCAAACAAG
GATCGTCGGCGAAAAACCAGGTGAAAGCAGGGGGCGGATTCGTTGTGTACAGTGAAAATGATCTTACAAGGATGAAGGAGCCGTGCTACGAACCAAGAAA
ATGGGTGAGCGACGTAAAGTTTAGCCCCGATAATCGTGTGCTTGCGGTAGCGAGTCACGACACGAAAGTCTACTTTTATGACGTGCTGAAAGGATTTACA
AAGAAGCAAGTGTTCAAGAAACACTCGAGCTACGTCACACATATCGATTTTTCGTCGGATGGAAACTACATGCAAAGCACTTGCGGTGCCTACGAGTTAC
TATTTAGCGAGGTGAAAACGGCACGACACATTACTGGCGCATCTGCGTTTCGAGATGAACGATGGCACACTA