Description :
Non Conding Region
Location :
scaffold_1:10793- 11105
Sequence
312 bases(100 bases per row)
CGGGTTTGACAAGGGATTTTATCACAACGGTGTTGCTTGGAGTTCACACGTATTGAAAACGAACGAAATTTATTTTTCTTCCGTTTTCACATTTTTGTCT
TCTACACACAGCAGGAGGCAACAACGACACATGCATGGCTCGATTCGACTATGATCAGGGCTGCCATTCGTTCGTTCCGCGTGGAAACTCCAAACTTATG
CCAACCGCTGTATCGCCTTGTTCTTGCCGCTTCGCCGCCCACTAGTTTTCGTTATCGCACTTCCTGTGCCATTGGTGACCGGAGCCTGGACTTGCTAACT
TGGCTCACTACT