Description :
Non Conding Region
Location :
scaffold_1:107816- 108106
Sequence
290 bases(100 bases per row)
CCATTTTGAACTTATGTATTCTCGAAGACAAGAAAGCTTCGATCGTTAGGCATTCAATAGCCCGTAAACCGACATGCCGTAAAATTCAGAATTCGCTGAT
AAAACGTTAGTAAGAGAAGTTAATGAGAGAAAGGAACGTACTGAAGTAACTAAACCACAAATCGGAATCCCGCTGTTCTCTTTCAAGAGTATCGAGGCAC
AGCAATCACGGAGTCTTCAATGCTTCGGCAAAGTCTGCTGCTAGCAAGTAAATGCACTGCCGTCCAGCTCACTCCATCGCCCTCCTCGTT