Description :
Non Conding Region
Location :
Scaffold_1:107762- 108281
Sequence
519 bases(100 bases per row)
TTGTAACTACCGGATAATGACCTGTATCCGGACTTGACGACCCGTTTCCAATCTGCATTCACAAAACGTGTCCGCTTGCTAAAGGTGCGACAATGCCCTG
ACAACCCCAGTAACGTGGGAGAGCAACTGCCTCGCTGCGCGCCACGTCCGTCGCCCCAAGCTCACGGCGCGTGATCTAGCTTCGACGGCAGAAGTCGTGG
AAAGCGTATGGAGTGGTCGAGCAGGTTGTGATGCACACGCTGTTGGGTCGCGCACGGTCGACGGCATTCTGGAAAAGGCATCATAGATTTAACGTCGTTG
TCGCAATAAAACGCAACTTTGACAGGAATGCCTCCCCTGCATGTTTCGAGTGAACGCGAGGGCAGCAGTCGTGCGCGGCGTCCATGTGTAGAGTCTGGCG
GATGCATCTTACTACGGCCGTCAGCGGCACTTCCAAACACACTAGTCGCTCCCCACACCCAGCATGCAAGCCACCATCACAGAGCATCGGTACAGTGTTA
TCGACAATGAAGCGCAAGT