Description :
Non Conding Region
Location :
Scaffold_1:107652- 107837
Sequence
185 bases(100 bases per row)
CCGTCTTATCGTTGATAATACTGCTATAATCCATACCCCCTTTCCGTATATAAAGTAATCGAGGCAAGTTGCATCAAGTACTTCAGATTCCATTACTCTA
TTTTCTCGTCGAACTCGGACCCTTGTTTTCGAGTGTATGGAGCATTTTTCTCGTTAGACAGGACAAAACTTATTTAGTGATCGAA