Description :
Non Conding Region
Location :
Scaffold_1:107607- 109668
Sequence
2061 bases(100 bases per row)
gcgacagtagcaagtggagcacttcgaggtaagatgacaattgccagccaaggattcaagagtatttaaaatagaaggtttatatacaccatcatttcgg
ttcttgtatgcgaaaaacataatgttacaggtaaaatgttttacccaatcagtaagcagaccaagtgttgcttcaacttgatccagataatggcacaatt
cgtctggcgatggcgatagatattgctgtacaggcagtcatcccgggtgtcttcgttgatgatggagtgacttgatgcgcgagactgtgttccatgtaca
tagtggcgtggagatccggaagcgctggtgagactgttcatcctcctaaccatcttcgcctgaaaggtttcttggatctgtccatggatgccatgtcatg
gagcattaataatctctagtacgcttcgttatttcccatctcaacgatctttaggcgttggttagccaccagagaaccctttagtccaagtcattcgaaa
agtggagcgttcgattcatccaagttgataaagttcgagacgcgaacgttcaccatgttccgacgactccattttacttgaattcctccacagccgccac
tggcgcaaggactggtctagcactttaaagtcgagcagctcacccccatcctccgttacgttgagcgctagctccgaaaactaggtctcacgttgcaaac
cagaaaacgtctgtgcaaacaagacacgactgctctgcttgcagaggttttcgttcagtagtttccacgacggtgtgtgatgtctgagccttgtacagtt
gcattcaatgtggcgagagatgccttcaggtcgacaacgcagccgatgcaaacataccgagtcatagtggaaagacacgacccttaccaacgcaatggtc
tctgctccggcttgttacagaagcttttcaccatggatttctactctcacttccgaatttgccaactccaacgcgctttaacttccgatccaaacaactt
ctccaatggacaaagagaccgtccagcagttcgtgaacgccgttgtagcaaccaaattgatcccgttgtcgtcggagccgcacaatggtcggacgtacag
ctacggcggtattctccccggctcagcagacccggcgctgctggaacttcctccaggcgttcgatggctctgcgacttatctctagcgactgaagtttca
ccacgtttgtacgtgcgtccagcctaccaggtgttgttgcttttggccatggcatttgtggaccaccctgaggaaccgcaccaccgggttgtggtcactg
gttcctcgggcaccggaaagaccagcttcctaagctggacactgtggcatttgcgccgtttgaaggaacccccggtcatcgtgctcgacatggccgggtt
cttcggtcggatagcgtctgacggagaagttactgccggtatacgaggctccagcttccaacgggagctcaaacagcgctccacagtgtatctgtgcgac
gcttcttgtgaagacgagttaattaacgcagaaatccaagctcgtagcatcataatggcaccgcctacactcacagtgaagagggagacaccatcggata
cgatgcgcacgttggtgctggtgatgccgctgtggaccatcgcggagctggaaatgtgtcgctcaacgtgttactggcgtacaaccacgccagaatcgct
gttgaggctctaccgactatggggtggtgtagtgcgttggaccttagggatgtccgagacacaggccaggcatgagttcactcgtagctttgaggcattg
tccttttcctcggctgtccaggtagtccgtaacggaggcctcgttgacgccgagagtgagagactcgagctcggatctcgactgattcacatgcacgtcg
acgctgatagcacctttgaactcagtgaggtggccatgtgcagctccttggcatgatcgatatcggcgacagctcgaaagtgctcacaacttaaacgacg
ttgaaccgagaactgtgtcgttcttctaccagcaggtacagtaagacctctttgacagggc