Description :
Non Conding Region
Location :
Scaffold_1:107524- 108859
Sequence
1335 bases(100 bases per row)
TGACTCGATAACCCCATGGTTATCTTGGTCATTGTTAACCGTTTCAGTTTGTCTCGCTTATTTCATTTCTGTGGTACTTGAGGACTGTCTTGGTCATGTG
CGTCCTGCTCGTCCAGAAGCATTCGCTTGGGGATAAACAGGTGCAGCCAAGGCTAATTATTCAAACGCGTAGTCTGAGTGAGAACGAGCTGTAGCATATA
AATTGTTTTGATTAGTTTTACCTTTCTCATAGGGTCGACGCCAGTGTCGGAAAAAATCGTCTAAGTCAGGACAATGTCCACTCAGTGTTAGCTCCAAGTT
AGCTGTTCGGCATCCTTCTCGTTGGGTTACCTGCCACGATATGATGCCCAGGTGGGCTATCATCATACGATAGTAGTTGGTGAACGTCTCCGACAGAAAG
CTCCATTTGCCGCACAAGTCCTTAAACCAAATTTGGGGGGCTTCTACACGAGCGAAAGCATAAGCTTACAATTGAAAATACTTCTAGCATGTCTGCATAG
CTGTAGGCTTTTGGCGTACCATCGATATAGAGGAGCGCGACTGTACCGTATATCGGAGATGCCTCGAGCTGAAAACCCATAAGTTCTTTGTGGGATACCT
GATGAAGCCTCACGATCAAAGTCAAGTTTTGTGCGTTTAGATATCAGTGCACAGCGCAACCGCACAGAGTGGATATTGCTTTTGCACCTTTCTTAAATTC
AAGCGACCATAATCTGCAGCACGGCACAGCGATGGCAGATCTTTAACCGAAATACTCTGCAAGTCTTGGACCGGGTTCAACGAGAAGTGACCAACCAGCG
TGGAATGATCTACCTCACCAAGTGAATAAAGCCAAAATGAGGTAGCAGTTTAGAGTTATAGTCGATGGCAACTGACGTGTTCCTGTTAAAACATTACCTC
GAAAAGGAGCAAACCACTTGATCGACATCCCGTTAGAGATCATGTAGAACCGCTTCAGGTCATCAGGAAGCACAGAGGGGGGATTTTTCTGGTCCAATGC
ATGGCGCATTAGCCCCACGATCCTACAGACTAAGACTGACAGAAAATATGTCACGTACCTGTTCCCAGAGCGAAAGTTCTACTTGCGTAGCCCCACTAAT
TGGTTTTGGTTCGACGCGGGATACCCGTTCGTGAGACTGCAGGTAAGAAAACACTCCCAGCGAAATCGCATCCAGGTGCTGCATTCCTTTGGCACTACCG
GGAATGAACAGGCGTCTCCGATTCCAAGATAGAAAGCAATCCAGACAAGGTGTTGTGAATCTCTAGCAATGTTACGACAGAATAGAAGTTGCTACAACAA
ttcagtttttttttttttgaCACGCGCCGATCGAC