Description :
Non Conding Region
Location :
Scaffold_1:107513- 107872
Sequence
359 bases(100 bases per row)
GCCTTCAACCGGTCTTTTATGCTAAAGAGGAGGGATAGTATAACATGGTAGTACTAGTATTACTTACTATACATAGATAGAGAATATATTGGGTTGGTGG
TGCTTCCGGGGGGGTCTATTTCACACTGTCAATCCTTCGACAAAGATTGAAAGTAGATCGCTCGGGTATAAGAATAACGCGACCTGTACGAAGAGTGGGG
TTACTTTCCATGCCCCGCACATTGAATACTACAGGTATGTCCATGCCCCATATATTATTGCGCGAGACACCCAAGATTCATGTGGCTCGAGGCTAAGAAT
AGCTCAGCATGCAGTACACTGTTTTGGACAAGTGATAATAGCAACCCCCCGACGATCCA