Description :
Non Conding Region
Location :
Scaffold_1:107360- 107751
Sequence
391 bases(100 bases per row)
AAAGCAGTCGAAAGTTTTTACCATTAGAAGAGCAGTAGAAGTCCACGATGATAGTGCGTCACGGATGTGCAGGTCGTAATCCTCGCTAGAGCTGATTGAA
AATACGGTCGAAATCGGCCATTTTTCACCGTCCAGTGGGGTCACGGAGCAATAAAACACTCGGTTTTTGTATGTAATCAGCCATTTTGTCTACCAGTTAC
AAAAATCATCAGATCGAATTCATAGGATGGCTCAGCGACTCACCCGCGAGTCTTTCAAGCAGTGGATCCAGGGGCTCGATGCATTCCTTTTTGACTGCGA
TGGAGGTACTGACTGTACAGGGAAACATATCAACTAGGAGATGGAATAGCATACATAAATGACTTCAAGTTCATTAATTATTTGTTATACA