Description :
Non Conding Region
Location :
Scaffold_1:107123- 107396
Sequence
273 bases(100 bases per row)
GCGATCAGGGCGGGGGTCGAATGTACTGAACTAAACGAACGTGTGCGCCGCGAGCCTCTTNNNNNNNNNNNNNNNNNNNNNNNTCTTGGCTTCCGCTTCC
GCTCGCGGCCCGTCACTCACTCTGCTCAACAGCAGCAAAAGCTCCTCACAGCGACTGGGGAGACGATATCACGGGATCTCATTGGTCGATAGTAGGATAC
CGGTACAATACCGGTAGTTTATCAGACTCAGAACCTAGACCGCTGCCCCCGAGTCAGATCTGCCACCCAAAAA