Description :
Non Conding Region
Location :
Scaffold_1:107022- 107489
Sequence
467 bases(100 bases per row)
CTGCACTGCAGGAGGCATACCGACGAGCCGACATGGGCTGGCCATGGCGCCAGGATGGTCTCACCATCGCTCTCCGCGTCGCCTAGCTGTTGGGCAGTCG
GCGAGCTCGTCGGACCGCTCGACAGCGCCTTGTCCGAGTCGTTGGCTTGCCACACGTACCGTCGTCCAGCCGGCAAGCGCACCGCGAGGCTCCACGTAGA
CTCGTCGCTGCTGGAGAGAGCTGCTGGAGCACCTAGCCCATTGCGCTTGACTCTGTGTGGCCACGTCGGCTAAGATCTGGGCTACGAAGAAGTGTTGACG
ATGGGTTGGTACCTATGGTCGGGCTCGCCTCAACGATCGCCCTTGTGTGTGGCCTGTCGAGACTGGCGCCAGCGTTCGAGAAGCTACCGCGCAGTTGTCT
CGAGCGTACGGTGTACGTGTCGGCTGCTGCTTATCTTCCTCCCATCGGCATAGATATCACCGCGGTT