Description :
Non Conding Region
Location :
Scaffold_1:106887- 107586
Sequence
699 bases(100 bases per row)
TCGGGAAGAGTGGCGAATGCATGTATATCCGGTTACCAATCAAATAATCCGGATAAAACGTTCCTGCGAGACTTGATGAGGTCGACAAATTAAGAGCAAG
AATTTGCCAAACCTGTGTAAATATATATTACGTGACATATTTTTTCACAGGTTTGGCTAATATTCGCTCTCAATTTGTCCGATTCCACCATACTTTATCC
AAGTAATTCTCAAAACAATTTTTTAGTCCGCTCCGAAATTGCCCACTTCATTTAATCTGGCAAGTTACCTCGTTAAATTGATATAATATTAAATTCTGGC
AGAGGGCCTCAAGAAAAAGATATTGTCTCAGATTGAAATCGGTCGCTCTGAATTTGAAACAGCGCTATTTTGGGATATTTTATGGATATTCCGATTTAAA
ACGAGATATTTTGGATTTTTATGGATATAATTCCGACTAGCAAAGTTCTTTTTGGTATAAAATATATTTTTGACAATATTCTTGATTTCTACACCATTTC
CCACCCAAGTCTCAAAATTTTCAAATCAAGCTACAAAATGGGATTTTAGGTACTAGCGCAAAAAGTCCTTTTTTTACGTTTTGCAAAATGGATGGGTACA
CTTTTCAACCAAACTGCAAAGCTAGACTACGCGCCCAGCTTCATGCCGTCTCCCTTATCTGCTGCGAAGCAATGACGCAGGCAGTGTCTCTCATAACGT