Description :
Non Conding Region
Location :
Scaffold_1:106657- 106961
Sequence
304 bases(100 bases per row)
tgtgtgagttcaatgcgaatgttagggtatgtgcatttgaacaaattggaaggatctctatgaggtgcggcttgtacgcagacagtgagatagcaagcac
gctttgcgatggggtgggcaaataaataaagaagctcgaggcactccattccccaaccgtctgcgcgtgcggcatgcgtcttcaactggaaactacgcaa
cttgatcagcgactgaagtctaaaagaaaacttcttcgtctccttcgttgctcacagtgtcactgtcgtaatagtcgaaggtgtaatcgttcatgtcgtc
gccc