Description :
Non Conding Region
Location :
Scaffold_1:106618- 106683
Sequence
65 bases(100 bases per row)
CTAAACCTTGCTTGGCATAAAACAGGCGCAAGCCTCTTTTGCTGGCCACCCGTCGCTACTAGGGC