Description :
Non Conding Region
Location :
Scaffold_1:106300- 106922
Sequence
622 bases(100 bases per row)
CAGGCAACATCACGTACGTGTTGGACTGCATTGATGACGTCAAGACAAAGTGTGCGCTGCTGGAGGCGGTAACGCGAAAGAAGCTGAAGGTTATTACAGC
ACTGAGCAGAGCCAAGCCGACCGACGCGTCTGCAGATTGAGCGCTCAAGACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNATTGATGACGTCAAGACAAAGTGTGCGCTGCTGGAGGCGGTAACGCGAAAGAAGCTGAAGGTTATTACAGCAACTGGAGCAGGAGCCAAGGCCGACCC
GACGCGTCTGCAGATTGGAGCGCTCAAGGACGCTATCCGTATGTTGGCGTGAGGTTGTGTGGCGTCGATTGGAAGTGGTTTTGACTCATGCTGTGGTGTT
CTCTTGTTATCTGATGCTGTGTCGTAGGCGACCCACTCGCTACGAAGATCCGGTACTTTCTGAAGAAGAAGGGCGTCAAGTCGTCGGATATCACGACCAT
CTTCTCGAGTGAGAAGAGCTTGTGTAAACTGCTGCCTCTGAACGCAGAGCAGGCACAAAACCCTGAGGAGTTTGGTAATGTGGAGAACTTTCGTATCCGT
GTTATCCCTGTGCTGGGAACAA