Description :
Non Conding Region
Location :
Scaffold_1:106250- 106990
Sequence
740 bases(100 bases per row)
TTCTCAATGTGCTTTTTCGCTCAGGAAAGTTTAACTGGTGTGGGTCTAGGCAAGGGGGAACGGCTCATTCGCCCCTTCATTGGACAACTTTGTTTGATTT
GTTCACTCTTCCTTGGTGGCTTCCAGCATACTCTCATGTTGCAACAAGTGGGGATTGACCTCTCCCATCGAATTTTCGAGAGCGTGATTGGCTAGAAGAG
AGGACTGTATCCATCTGATTGGATAAAAACGAGACTATTGAAGTGGGCTTGGAAAACAAAAATGCAACTCTTGCAATATGGAGCAGGCTGCCTTCATGAC
GATGCATCGCAGCTTGATGCGCGCTCTTTCGATGACAAAGACATGCATGATCGTGTCAACAGCTATGCCGTATACGTATAGGCCACATAGGTAGTGTGTT
TGTGGCCCCTTTGCGTCTCGTGTTTCCATTTGAATGACGCATTGAGCGTCGTCAATTGGTGCGGAAGGAAACATGCTCTAGGCGCCTTCGAGAGAGCATG
GAGCCGGCGCATATAGAGCCACATCACTGCACTCTACGTTACTTTCTTTCTTCATTCATTGTCGGAAACGCATGGGCACTTACTTCATCCCTATCTATCG
ATGTGGTGACTCGTCAGGATGCGCGAAAGGGTGCCTCTAACGATTCATGTCTGTTAAAGATCAACGCTACATATCTAAAAACGCTGTGGCAAAGGAGAAA
GATTCGTCTGACGTATCAGACATAGTAAATAGCAGCTACA