Description :
Non Conding Region
Location :
Scaffold_1:106141- 106163
Sequence
22 bases(100 bases per row)
GAAAGCACATTTAGACGAAATC