Description :
Non Conding Region
Location :
scaffold_1:106119- 122173
Sequence
16054 bases(100 bases per row)
AACGACAAGATAAGAAAAATCGCGCGTTTTCTCCGATGACGCTGCATACTAATGATATAGAGACTAAATGAGTCTCGAAGTAAGCACTGATTACACAAAC
ATATGGCAACCATGAGACCAGAGACTACGTGAGCATCTAAACTAAATTTGTGATCAGTACAGTTCGAGCTTTTACTTTTAATTAAAACACCGCGTTTAGA
AAAAGATCAGACTGATACAGGTTCCACAGCCACAAAATCGGTCAAGTGTGGAGATGAAAAGGTAGTCGCTAGCGTGGATTTGCTGATTGGGTGTTTCCCT
CCAAATTTCTAGTCGTATTGTTTGATTGAGATCAACAGATTGTAAATCGGTATATTGCGTACCAGCATTCTGTCATGACTTAGTAACAGAGTGGGACGAT
GGCATCGTCAAAGATGCAAACTTTTTGAATTCCGACACCCACCTGCTAAAAAAAAAGGTCGGACTTTAGCAGTTCAGTATTAACAGTCAATCGTAGAACG
GCATTCATTTGTAAAGGATTTGCTTCGCCTTTTTTATTGCTATCGAGTCAGTGCGATTACCTCTTTGTTAGATCGTGTAGATATTTATGAAAAAAAGTAT
AGAGGACGAGAACTTGCTCAATTTGCTTAAATTGTGCAGTGAACGATACACAATTGATTGATCTCATGTTGTTTATTATCCACGCTTGACAAAATAAGTT
GATCGGATTATAGAAGATATAGAGAAGTCCTCTTATGTACTATAAATGTTTTGGGTACAGAAGACATTGGTCTTCCCTTTACTCTACAGTTGTAGCAAGA
AATATAAAAGGATATTGCTCGTGGTTACAATATTGCCTTTGATAGCCAACATGTGTAATCCTTACGATTGTTTAACCAAGTGCATGCAAAATAAAGTGGT
GCTCAGGCGCTTTCCTGCAAAAATGAGTGACTTAAtctttttgattttaaacTTCAGACTTAATAAATATATTGACCACTTTATGGCATTCGGAATAGTG
ACATCTTTAACATCTCATTGAAAATGCGACATTGCTGTTTGTGTGTCTTCCTTTTTTTTCGACTATAAGTTCATGTCGATTATGTGTGGCCTCAAGTTAG
CAGTTTTATCAGAGGCGAGACGTATGCCGTCTGATATAAGTAGTCAGGTAAGTGATGTAATTATTTAATTCGCAGTGGCCAGCAAGATCAATACGTGAAA
TGCCAAATGTGGCAAAGGGATGCAGCCGCAAATGGCGTTATCATAATCTGTACGTTCTAGCTCGCCAgaaccgatcctgtggtgcagtggtttaCCACTC
ATTTCAGGACCGGGAGGTCCCGGGTTNNNNNNNNNNAAAGGAGGTCAAGGCGGAGAATCCAGACACGATCAAGTGCGACGCAGCTAAGTTGGAACTCTTC
CTAGGCAAGAGAGATGGCGGCGCTTGGTTGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTAAAAACGAGGAAACTGTTCTTTAATTGGTCAACAGCAACCTTGTTATTTAAGGTCCACACATTTCTGATATTCTAACAGTGACTTGTACACTCCGT
TTTCCTCGTGCTTAGCCAAATCTTGCAAAAATGCAGTTTGATCCGAGGAACGGTGATCCTGACCGTAGGCACTGAATGCTTTAGAAATCAGGAGCAATGA
GGCCAGATTGTTATCGACTTCTTCAAACGCTTCCTTAAGCCATTGAATCACGTCCGTTCGTTCGACCTTATATTTGCCTCCTGGACCTGGATCAGATCGC
ATTTTCCACGAAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATT
TTGTCATGAATGCTCAGTTTCTGATTCTTTTGGCGATTGCCGGTTGAAAATGATGANNNNNNNNNNCagtgaacggcagttcacagatccttggtcagag
gaacgttaaccaaatttaggtagttNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TCATACGCATCCCTATAAGAGGATGGAATTGACGTAAAAATATCTGCGACAGTAAATGACTGCACATAATGGTACCATTTCTCTGAATACTGTTTCTGTC
GAATCCAGTTCTCGAAGGTATCAATGTTAACACCGAAGATTGAAGAGGTAAGTTCAGCATCTGAATTGCCGGGAGAGGAATGAAGGTAGAAAAAGACGGC
TTTTTACTTTTTCTCCCACGTCATAGTGCGGTACATCTCTGATGTCATCTTGCCCAAATTTCCNNNNNNNNNNTTGCATTGACCAAGCGCGTCACGCCAG
CTGATGTCATGGATTGCCGATAGGGTTTGTTGATTCTTGGCAAACCTGTAACCAGTTAATGGGTACTGTCTGAGAGAAAGACACTTTACGAATTGAAAAT
TAATGTCTTTTGAGCACTCTGGTCAACCACTGCGACAGAGCTGGGGTGATGTTGCCGGATCGGATACCCATTGTACGCTTCCATTCGGTTCGGTCGTTTT
CAGATTCGTGCCCAAATTTGGATATCAGCATATTATAGNNNNNNNNNNAGCAGCTGACAATGTCGTGCCTCAATTATAATTTTACTAGGTATTCGGCTGT
TGGTAGAGTTCGGCTGGATAAGTGGCTGTAGAGACTGCAAATGCAACTCCGGGAACATTTCTCGACGAACTAGGCGAGCGATAGATTCAACGTGGTCTCG
CCCGCGTTTCCTGCGTTCTTGGGCGTCTACCCACTTCTGANNNNNNNNNNACGACAAACTTTTATAAGGTTGAGAGGTCAATGGCAAGTAGCCAAAAACA
CGAGGTCGAATGTCATGAATGCGTAGCAACTTTAGATGGAAAAGGAAGCTCTCTATTACAAAAGCTGCATCTATAATCTTTAAAGCTCCTCAGCTGTACT
CATTCTTTTCAGTTAGCCGATAAAGGCGTCTGTCGTGCTAAAAAATGACAGCGAAGCGGCGAGCCTTCGATTTTAAAATGCTAGTCCAGCCAATACTAAG
GTGAGCAATGACAAAACTATAGATTTATTGAGAACAATCTGGCAGAAAAACCGAAGCCTGAAAACTTACTAACCCCTTAGGACTTTTGAGCTACTGCTAA
CCTGTGTCGAGTGTGCATCTCATCGGTAATTTTTCCAGAAAGGTTTCGCTGATGGAGTCTGCAATAGGGATTTGGTTAAGACTTTAACTAACAGCTAAGT
GCCGCCAAGATATTGATGCACATATGCTCTTTGTAAATGTTGACAACAAAAGGTCTTGTCATATCAAGCCTACTGCAATCCATCTTTATATGTGTGATAA
AAGCAAATAACCGATTCAAGTACCTTACATTGCCGTCTGATGTTTTTGTTAGTCATGATAGCTCCATTTACAGACCAGCTCTGCTTCTGCTTTGTAAGGA
CCGCGCTATGTCGCAGGTActtttcagcttttgcatGTGATAGACACATTTTGAGTCAGACATAAGCACCTCGAGAATCTGAACATTTGGGAAGCTCACC
GGGCTCGTGGTAGGTCGGGAAATCAATAGTGACATTCCGTGCATCGATCGGCTGAAAACCAAATTATGTCATTGAAAGCATTGTGTTCTGATGATTGAGG
CATTTGAAAATTCTCGTGATTTAGAATAATATAGGTATTTTTTGCAATATTAAGTCGTCTCTCTATTTGTTAGCTTCTTTTGTATAATCCCCATATCGTA
TTAATGTTTTTTGGACCCAATACAAACACTGTAGACTTTGATCTTTGTGGCCAGTACTGTTTCTTACCTTGTAAAAATCTCGCCGTTATACCCTTGAAGC
ACTCACTATAAAACGTTAAAGTCGATTTCGTAAGCCGCCCAATATTCATGCTCATACAAGCTCGTGTGTTCTTTAGGAATACCGTGCACGAACACTACGA
GGAACTGCAAAGTTTCATTTTCCCGATATTATGGTACACGGTAAGCGTTACTATGACACCTTTGCCTATTCTGAAGTAAATTGACATTATAATACACAAT
TTTGTTAACGCACATAACACAAGTGCGTCATCAGCTCGCCCGgcaaatttaataaaaaagTGGATATATACAAGTTTTAAAGAGGGTGATCTTGGGCTTA
CTTTATCGAATGCCTTCATTGACGCCATGCACTCAAATTATCTACGCGACGGCATTCCAGCCACAGTTGCCATACCGAATGATCCTCGCTGGATGTCACC
AGTATCGGCTCTCTTTTCTATGACTGTACATCCATTGGGAGAAGATTTCGACCTTATACTCCAATAATAAGGAGGTTACTGGAAACATCTATCTAATTAC
TTTAGAATCCTTTTAGAGCTTTGTGCTGCTTTACATAGCTCACGCGGCGCAACCAGCTGGAAGTTGTTCACGCAGATGTCGTTCTGGAACAACCTTCACT
TCATGTTTGGGAAGATGAAGGCATCTTTACACATTGTTAGTCCAGGGACGGTGGATTAGCTGATGAAGTTGATGACCACTGCGAAATATACATAGGATCG
TTACGCTCATTCGGTTTGTTCGGATGTTGAGTTTCGACTACAACATAATGCACTGGGAATACGATACAAGTGTTAATGGAGAAGGTAAGTCAACATATCA
ACCACCTGTAAACATGTGTGTATAGACATCGAAGATGATAAACAATTGTTTTGAGATTGTCCTGTGGCTCGTTATCAATAAAATTATTACCCTGAGCCTT
TCGGTGAGCTAATTGCAGGAGATTTCGATTGAACTTTGGTGATATTTACAGATGTTTATCAACATGCACCTACTGCAACTAAGCTCTGTGGGAGTTTTGC
TATACTACAGCACTCAACATAACTATATTTTGTGTTCTATGCTCCCTATTTCTACATTGAAACAAGAGCTGTACAACACTGAAGCAGCAACTTCGGCAGG
TTTCGTATGTAGCCACGCTAGAGCTTACATTAAGTGCACTTTTGCAAGCCCGCAGAAGTTTTTAAGGACAACAAAAGTTTAGTTAACAGCACTGATCAAC
ACAAGATTAAGCGTTTACGACTACATACAGCGGGTGGGCACATCGAATATCGAAATGGACTTGGTTGTTCTAAATGGATTGGTTCACTACAAGCATTAAC
TTTGACAATGATCATGCCTTCGACTATGCCTATATCTTCGCTACAGCCACGACGATAATAATGACGTCATGCAACTGAAACTTCAAGACCAACGGACGAA
TATATGGTAATGCGAAGTCAAACTGACCTGGGCGCGTTTATTTCTATATTGTAATATATTGTTGTATATTTATCGTGGAACGCCGAATCAACTACTGGAC
CCAGATCCAGACCGAGATAGTGGGGCTACCTTACATCTTTCTGAGGTTTTGGTTACGAGGAACTACATAAGATTTACCACCGCACTTTGGATCTAGCTCG
TGGATCACAGTCCATACCAAGCACCTAACACCGATACACTTGCTTGCGCGCACATCGACAACAGGAACAAATCCACTCATAGGACACTTTTCAGCGCAGT
ATTGAATTTGCTTACAGAAGTCAACCTCGCAAAATTGAGCTTCGAGCTGGATCGACTTCCGCTTTTCCTCCACGAGGAGCCCCTAATGGTTCGACACAGC
AATTCTTGTCAATCTTCAAAACGCATCCCCTTAAGTCAGCTCTTTGCACCATACCAGCTTATCGCTCTCTGCACACTCGGATTGATGGCTTTAACCCACC
GCCGGGGCAATTTGCTACTGCTCACTGACATGGCCGCCCTCGTGTCTCGACATGGCCGCCCACATGCCATGTATAAAAACGTGTGTCTTCATAAGTGTTT
GATGTGTTCTTAGCCGATGTGAGGGTCAGTCGAGATGCGGAAAGCAAACATATAATGAGGCCGCAAGGGGCGATGGAGTTCATATAATCTGAATTTAAAG
AGAGTGACCTCTTGGCTTCTGTACAGTGTCTTACTATCTGCTGATAATATATTGAAGGAGGTACCAGTCATTCACGCTCTGTACACCACCTTTGCTGTCG
AGTTAGAAGTATAACGAGAAAAATTACGCAGTCGAGCCGGCCAATAGACCTCTCTCCGGAGATGTCGAGTCCCGGTAGACACAAAGCGGACCTTCGCTGA
CTTGTCTCGGTCATAACTCAAGTCAACGTTATATCTGGGTGAGAGCATGTCAAAACTTCTTTATATTTTAAGAAATCAAATTCCAAGAGGTCTGAAACGC
TTCACAACGTGAAACGATGTATAGATTTCAAACTGTGGTACGCTATGATCCGAAGTCTGGTCTGTCGGGGAGACCTTGCACAGCGGAATGAGTCGAATTA
AATGATGCACGGTATCACCCCAGTTTCTTTGGTCGATACTTGGTAGGGCATTGTTCAGCTGNNNNNNNNNNAaagtcgtcgccagggtcaaacccaatat
ctggtgaagtgttgAAGAtaccccgactccgaaaactcgtgggggGTTGAGGCggcactttggcaagattgctcagtcgccgtggacgcttttgatcgga
ataatcgggacgtcccgcgtcatcagacgccccgcgctttccggcaatagccagggaagtagaacgGGCAtgggctgagctcaagcagtggccctgagct
cttgcagtcGCAGACATAGAGCTCGCGAGAGCTTCAAGGGTTAATCCaaacgtcgcagggcgacaatccgaggAAGCCGAcgtcgtgccttgagtttggc
aacctCTAATcagaggtgtcgctccacacgcacgtccactttcttttGGCTGAAttgtaggttatacagtgaggaaagcttccggtgccgttgcatccat
tgctcaaagagcgcttcgtcatctgtagcgcttttgccaggggcgagcattacaggtattgtccgcattgcgggtacacgagagccacctcgttgagact
cagacgagtgcggtaagcttccaacggaaattcttgcggaaccaagaaacgagcttgaagagcttttcgtttggcaagatcatcttccgttctggccagg
ggcccgatgatgtggacgctttcgatcgagttaccgcgtccttcgcttccacagcgggaccCGCTGGGAGGAAACCATACTCCACATGAGGGTCAAttac
cggccgtggatgggcgcgcttcagagccgccttatgggcagctggaagctgccgcctctgtgccccgtcgagatcattggtgatgacaccacgttcatcg
gttgacgagaagtcagggaacggacatgggggtCCGCACGGCGCGAGCCGGGCTCGAATTACGCCGCTgacgcagctcgccttcctcgtcatctcatgcg
ggaaaagaaatgtcagactcgtagtcgaccacctccacatccccaacgaaGTCaatcgtcattgatagcgagcGCAAAGCTCGACcttttgctcatcgag
cctagtatatacatcccccggtgccgcggacgcactgtaagacattgcaccgcgtgcgggagacgaagttgtgctctgcccgtgttcgctgtcaggACCA
GCgaaacttggtgacttcagtgtcgttgtcACACGGCATATtggcacggaagtcgttttttccaacgaaccaagttgcagtgtctaacggacacgcgagc
cttgttgaggcaataatcgattggaactgtgaatgttctcaatcttaatgggggacagtgtaacgggattacacgtaccctggtaacaggtgtgtgtgac
acacgagatgggcatggtgtgactgcacccaaacaagaatacggtaNNNNNNNNNNgcgttttgggtactcttagaggtagcgaattgcgatccgctaca
ctcgtactaatTCTAGTTCATAACGAAAGGTCGataaccttagcttagctttcaccaagcaaagatctacggcagccccgctgcaagctCGACAAGTTTA
TAAGTGCACTGCACCCATATCGTTTTTAATTTCATGCAGAGTGCCGTCAAGTAtgctccacgtgcatctgtCTGTNNNNNNNNNNTGACATGCTCATGGA
TGCTGTCTCTCTCCCAGGCTTAGCCAAGAAAGTCATGTATCAAACCTTGTACTCTAAGCTAGATCCAATCAAGAGAGTACAGGGATCATCATTCAGCTTT
CCAGTGAATCGTTTCAATGGTTATCGTAAGCAAGATGCAGATGCTAAGCGAGAATTTCATATGGGGATCAGCCATCTCAATGAGCTTCTGGTCAAGCAAC
GGTACTCCTGCAAACATTGTGGATGTGCCCTATCCGAAGAAAATGCATCAGCTGACCGTATCGATAACTCCAAAGGACACGTCGATGGCAACATCATGAT
GACTTGTATTCATTGTAATGTATCACGTTAGGACATGTCAATCAGCTATATGAAACGTATCGAAGCAAATACCGACAAGGTCGTCTGGTCAATTGATGCA
GCAAAATTGTACCATTGTCTTTTCAATACATTTGCATCAAATGCGTTCAAATTTGCTACGTAGAGACTTTCGGTTTCGATTCTGGTAGAAGAGCTTAGGT
CGAATCTCTGTGCATTTTTGGGCGCAAATTGTTAGAGCtgacgctttcgcgttcacagTGCATGGCATCCGTTACTCGCTGCATGGTGTACGGATACCAA
TACAGTAATATGTTTCTAAGCTTAGTATCTCGTGATTCCTTTCGTCATGCATATCTCATTGATGCAATGCCTTAAAACTGGCAACCGTCTTTATGATATT
TCATCACTCTGATATTTCACCGCTGTTCTATTAATGCACGTATCTCTAGTGAGACGTTTGATTGCAGCTAATGGCTGAAGTTTCCAGATACAATCCTGGT
GGGCTGCGTAAAGGCAACAACGAGTCGCGGTCTTAATATGCGATCCCGTCGAGATGAGTCAGAGCGGCTCAATGCTACAGAATGGTAGAAAAGGACGACC
ATCAGTTCTCAGTAGTTGGCGGGTACTTTAAACAGTTTTTGCCGAAGCTTCTCGGTGAAGGGCGGATCTGTATCCGATGCAATGTCTACCAGCAAGCCGT
GTTGAGTGAAACACCGCAAAAAAGCTTGGCTGGATCATCACTGATTACGTACAGAGAGATTGACCATTTAGTCAGGCGGTCCACGAAGACTAAAGTGCAT
GTATTTTCTGGTGCAATTTTTAAAAACTGGATATAGAATCCATACTTTCCAATTGTCAGCACTCTGCCGGACCCCGGCAGCTGGCCAAAGATGCTGCTTG
CGAAAGTGAGGGTTTGATTCGTCAGCACATTtcacatgtgcgcacataccAACTTATACAATTTAGCCAGCATTATGTTCCGCTCACAAAGTTATATGTC
TTTCATTTTGTGATATGGCCACCCAAGGGGTATCATATGTCTCGAACAGTACCCTGTACTTGAGACCCTCATCGTGAAGCACCTTTAGATGCTGACTGTC
ATGTGGGTCAGtactataatacagcaaacttCGTGAAAATTGATAGCGGCGCAGACGTACGACATTTGCACTTCTATAGAAAACACTTATACTCTCGAAC
ATTTATCAATCCATGCGTGACGCTTCCGATGTCCACGCTATATGAATTTTTCCATCGATTAGCGACGTCATCATAAATAAACGACGAAGCACATCAGCCA
CCACAACATGCTATCCCGACTTATACCTTGCCTCAAAGGTATACTCGACAAAGAGTGGTAACCAACCGTCTTGTTACTTTTTGACCGCGCCAATATGCGC
AATGACGCATGCTCTGAAGaaatcacgaacggcttaaATTCAGGTAAGTATACTCTAAATTGACGAGGACCTGCTTCTTTGCATGTATATCCATGTTCGT
GAACAGGGGGTTCTAAGCTACAGTCCTAAGCTCACTTTAGTTCTCTGTGTTTGTTTATATTCTGCAGACGAGACACTctaacgcgatcacccgttCAAGC
ATTATGGCATCTGATTGATGTAAAGCGCAATTTTTTGCAACGACCGAAGCTTCCAAAGATGACGCGAGTGTAATTTTTGATTTCAAATGCGCCATAATGC
AGATACGCATGACATTTCCTCACAACATAAATACCACTATTTTCTGTGCTTCAACGCAATTTAACATTCTTTGTAAGGGCAAAACCCAAAGTGAAAAGGG
ATGACTTAAAATTGGCACGATGCGATGGTACTGCTAAGCCGACCTTTCTGTGTAACGGCTCCACTGTGTAGAACAGTACAGCTCGACGTATTTCTCGTGG
ACGTGAGATTCTCTCTATTTTCCTCAGAAAACCTCTCATTGCGTTCGACGAATGATCTAAGGGGATATTGACAAAGTATTACAAGTCGATGAAGTTGGTA
CGATTAGTACCGTAGGAGCGCCTGAGCCCATCATCCGTTATCGCCGAGTCTATTGTAAAAGACACTCGCAGAGCGCTGAGGTGAAACAAACACATCCGGA
GCTTTCAGATGCTTTTTCTACAGTATTGCGGTAATATCATGATGTGGCGACGAGAGATCCAGTACCAACACACCGGTTTCGCGTAATGATTTCTACATGG
TTATTGAAAGCAAATTGTACCTCAATAGACATTACTAAGGGACGATGTGACATCAtatattcttcttcttgcaaAGCTGGAAGCAGGATCTGTGCGAGGG
TACTGATTCCTGTACTCAGCGTTGCTACAGGGGCGACAAACAACGTGCAAAGATGGGTTCATATGCTCCACTCGAGAGCAGAAACGAATGCTCCTCGACT
AACTCGTGACTCAGAGCTGCGACATAAGTCCAAAAATGATGTATTATAAAATTATATTTGGCCTTTATTAATGCCAACAATCTGTTTCACGATGTTTGAC
CACAAATTTACATGTACAGCATTATCAGCCCAGGACCTCTTCTATATGAACTGTCATCACTCTCAGCAATTCACGTACTGCGAAACATTAAACGCGGAAC
GTATCCCCTTCTAAGGTCAGAAAGAATAGCGGCAAGTTACTAATCAAGCATGCGTCTAACAGCTTAAAGACAGTCAATATTACGACACAAATCTTGATTC
CTTTAATACATCGCGTGACAGCGCTCGACCAGGTACATCCAATTACCAGATTTGCATTTACTAGTGGAATCTTTCTCGAtgaccttaactaagcttcATC
GAAGCAacagagctacggcagtcccatTGCAATACTTGTAAATAGCACGAACATCTGGAGTCCGTATGAATGGTTTTGAGCATTGCTCAAGTTTATGCGA
TCATTGTCCAATATTGACAAGTTCTTTGGTGACGAAAAATCTACCTTTCTGGATACTTCATTGGTAAGCAAGCCCCACGAGCAGAACCCGCAAAAAATGA
GTTTCATGGATCAGAACCCTATGACAAAAAGAAATTAGGTGTGTATTGGCTTGCCCAACGTCTTGAACAAAGATAGCGCAAACTGCGCCAATATGGTACA
GCCCGGCATCTATCTCCCTGAAAGGAAACCAAAAGGTGCTAGATGCTGCAAAAATGCAGCATTCTAAGTTCTGTAGGAAAACGTCGCGTGTGTTCCTTCC
AAATCCGGATGGACCTCTCATTTCGTCTATGAAGCATTTGTCGCAACCAGTGCTTTATTTTTAACAGGTGCTATTGAGCATGCAGGTGCAAACGTGTTTG
AGTCTCACCAGCTTATATCCTCAGAAAGAAATTTGACAATTAATGATATGGAGATACTCGCGTTGAAGCTGGTTTTGTCAGGTTCAGGGTGGTTTTAAGC
CATCTTTGCTCTACATAGATTATCTGCTGTTCCGCACAAAACCATCGTCACTACATCTTTCGCAGAGTACAGCGACATGGTCATTTTTCTTGTTAGGTAT
ACCTTTGAGGTAAGGTATAAAATGATTAGTTTTGCGTTGAGGCAAACGCGCTTCGCTTTGCTTCATCGATTATCTGTTGCATTATCACGATGACGACACT
GCGCGCTGATGAGACGATATCGTTTCTCTACCTCTTTCAAGGTTATCGTGCACTCTGATCCCATTCGCTAGAAGTGGTATGAAACTTTGCGGTGAAGCTC
ACGGCAACAAACAGCTTTCTCCAAAGCAAGCTGAATTTTGCGTAGCAGGCAATGCTTGCCCAACTGTTCCTAATCATATAATCAATCCGTCTGTGTTTTT
TCGCCATTTTTATGCCTTTGCGCATATACACGAGGCCCTCGTCAATAGATAGCCCCATACAAtttgaaaatcaagaaagTCAGTTCTTAATACTGCGACT
TTGGTATATGTAAGCAACATCCGAGATTAGACCCTTCTTGCTTAAAACGTTTCTTACGATGCGTCGCATGTCCGTACGCTATACGTACCACCGCATCAAT
ACGCACCACCTGAAGCCGACCCAGCCAGTACTTATCGCGGCAGAAATTCCGGCAAAACTGATAAACGTCTCGCCATTCTTTTGAGGGATGTGgtgacagc
gttgctgtGGATAACAATGCGTGATTTGTATATACCACAAAAGCAAAGAGCAAAAAACGTCGTATACACTGCTTTTGACAAAAGCATGCAAGCAAACCTT
CGTCATAAATGGAGTAGCTCTTCACTGACGTTAGACGCTGGTGAGACTCGAGCGCAATGATACGTTCATGCCCATTGACACGGCCTTGAAGCGAGACAAA
GCCAATGAAAACACCCATAGGATCACAAACGACATTATATACCGATTTGATTTAGTTAAAGACAAACAGAATGCTCGCTGTTGTAGTCTTGAAGGTCCCT
ACTTTACCACACCCAGACTTCGATCATACACCCAACGAAGATTGATCTGGGATCGGTGTAATTTGCACTAATCTGTCCACTATTGTATTTGTCTGTGCAA
AATCTGTCTGCAGGCCATACTTCACAACAATATAGCCGAGAAAGCTGGAATGATAACTTTATAAACATACTTGTTTATATTGGTAAACAACCCTTTCAaa
cgcatacactcgagcgcCGCTCGGTAGTGATTGGTACATCTGAATTTTAATCCCTGCACTGATGAGAGCAgatatatcgtcaaaattTATTCACAATGTG
GAATGGATGTCTGCACATACATAGGATCGAATGTCGCTGGCTCATTCGACAGTCCTTCCGGCAGTACCAGTAACTTCATAAACACTCCACTCTAATTTGC
ACCGCAGACTAATATCGCTGTTCATCATAAACAGTTGACAATACTTATGGAGCTTGTCAAAGCACTGAACAAAATGCCGCCGACCATGCTGTTTTGCAGC
ACACCCATTCTACAAATCCTTATAGTACCGGAAGAACGAcagcatttagcttattacACGAAAGCACAATTCGCCTCTTGCCGTTAGCCTTTCCGATACA
GAAAATTGGCACCGAGCAAAACCATATACCCTCTCTCACCAATTTTCTCTATGTTCTTAGACGACGGAAAGCGTTGATGACATAACATTGTTTCTTTTAT
ACAGGGCGTTGTTGCGTGACGCAATCGAACCGAGTCATGACGCACTCCCCTATCCAAGAGTATAACGCTTGGCGGATATCTTGTTCTCTCATCTTATCAT
TCCTACAGCAAAGTATACAACAAATTTATGAGATCGTTGTAAATAGATGTATCACCTTTCAAACTCAGTGCTCTGTAAGTGCACATAATGGCGATGAGCT
CTGCTCGCCACCAGCATCAACCGCACCATCTCAGCAAACCAGTAGACTTTCAGTTTTCGCGCAAATCCACAGAAATGTATCTTCCAGCTCTTATAAATTT
CTGCTGACTATACTTACAATTTTTAGACTACCCCAGCCACTCTATTGAAGTGAATAATCTTTCGCATTTCCTACTCGTCGATCTTCAGTACTCTGCACGA
TGGGCACGTCTTACAGTAGAGCTGACTCAACAATACAATCACATCATAAAAGGA