Description :
Non Conding Region
Location :
Scaffold_1:105598- 105951
Sequence
353 bases(100 bases per row)
CTCGAAACCGATGCCAAGTTACATTGGACGGGCAGGCCGTGTTAATAGTGTCATGCACATGATATAGTGTAGTTTTCGATACAAGAACGTTTCGAAAAGG
CTCGGCGCTTTTTACTCGTGTTCACTTCTCGTTGTACGATACCGCGGTGGCAGGTTGACACTATGCATCGCAGCTGCCTCGTCGTGTACATACGTTTATA
TAAGGTGGCTACTGGCGCTTGCCTCGTCGTCCAAGTCGATGAGGGCGGCTATATCGGCGTGGCCAAGATCCCGCGATAGAAGAACTATGCGGTGATTCGC
TGAAATAGTCTGGATGCGCACGGCTTTTTAGCCAATGGCCTTGAGAAAAATTG