Description :
Non Conding Region
Location :
Scaffold_1:105597- 106212
Sequence
615 bases(100 bases per row)
ATGTGCGTTCGACAGGGCGGAATCGGAAATGAGACTGGTATGCGCGTTTCTGCCACGGAAGTGTGCCAACCATACTGAAATCCTAATAGTTTTCTTTTTT
TGAATCTAGATTCGATTAACGACAAGAAACGTTGAAGTCGTATAGCGCACATCCAAGGCGAATCTTGGCGAGGGTAGGGTGGACGGGTTTTGTGCAACGC
TTAGATGTGGCAAACAGCGCGTCGGTGACACAAAAGGGACAAAATACCCAATTACAAGAGGCTTTCCAccgtagttgcctctagatgtccgtggctatcc
gaatcgcatcacggcctccgtcctaagctgttctacacgaacctacgNgctggcgtctcggtcttggatgaggtggcagagtgcacacctccttgacacc
gagctGCTTGTCGAGGCATCCGCATCCCGAGCACGTATCGGACGAAGAAacaagctgcttctcgaATCGCTTGCATGGCTGCAAGTATAGGCACGCTTCA
AGCCTTCTCGATTGTTGAGATTCGGTCGGCGAATCTTGTTGAAATCAAAAATATGGCAAAGTGCATTTTTTGCCACATTTAAGGAAATCGATCTTGAAGC
GGCACAAAAGTCATA