Description :
Non Conding Region
Location :
Scaffold_1:105505- 105564
Sequence
59 bases(100 bases per row)
CATACACAGTCATAAAGTTTGAGTTCGACGACAAGACACAAGCAATACATCATATCAAA