Description :
Non Conding Region
Location :
scaffold_1:105413- 106754
Sequence
1341 bases(100 bases per row)
TTTGCGTTGGTTGGGGAGCTACTGACACGATATTGCGATAAGGAACCCCAATATTGTCAAAATCAAATGAAATTGTTTGATTGGTGGGTTGGAATGTACT
TTTATAAGTTACAACATACCAGCTTGAGGACGTTGAGCACTGCAGCCGAATCGCCAGCGAGTGCCGACACCTCGACGTAGTTTATACTGTGCTCATTGCA
CCATGACCGGACAGCATCTTCCTCATTCTGAGCATCTTGTGCGGAATTGTCACTCTTGTTGCCTACCACCACAACTGGTAGCGGCTTTGAGGAGGGGGCA
TCAGCTGAGATCGCTTGGCGGGCAACGTCGAGATACTTGGGGAGCACCTTCCAGGACGAAGGGGTCTGCAGATTGAAGACAAGCACAATTGCATGAGCCC
CACGCAAGTAGCGAGAGAAGATGCTTGGGCCTGCGTAGCTCTGCGATGGCACGTCCCAGAGCTACAGACACGAGCGTGTCAACACACAAAGCAAGTCGCC
ACTAAGTAAGTAAGCGGATGACTCACCTCGACAACAACTGGGTCGTGTCTCTCCAGTCGAAGCAACTTGACACCTACGCTGGCTACGCGGCGTTGCACCA
TCGACGAGTTGTCGTTAGCCCTAATTCTCGCTGCATGCATTGCTCGCTGCTTGCTCACCTGTAGTGGACGGAAAGTAGTCAGCGTCGAGTGGAGTCCCCA
CCCAGCGCCTGAAGAGCGTCGTTTTGCCTGCGGCTGCCTCGCCCAGTATGACCACCTTGATCTTGTCTGCAGAAGGTGAATCCGATCCCGTCGACTGCGC
TGCAGACGCGTGCCTTCCCAGGCTGGACGCTGAGATAGCAACAGATCATTAATCGGATGCAACGCACAGTCATCGTTGATAACTCTGTCGCTGGTGCTCC
ACCAGCCCGCGCTGGAGTCAAACATGGCACGGCCCTACCTCGTCCGCCCATACCGTATCGCGTCGTTTGGTGACCGAACGCGCCGCCTTCGGACAACCTC
GCTATCCTTATGGATATCAACCTCTTAAACACAATATGTTTCGCGCTGTTTAAGCTCTTCTTTTGTAAAGAAAAAAAAAAATGTTTGATTCGTATTTATA
ATAATCCAGCACATTCATATGACATCGAACTACACAGGTTTCTCACACGTCGCATACTCCTCTTGGTCCGCCGTCGGATAAGGCGGAAATCGGCCGCGAT
GTGCGCGTTCAGAAAGCTACCAGACCCACGAGGAACCCCAGCGCTGCACACGCAGCTCTTCACTCTGCGATTTCCTCATCCGCACGTAAGACGCCGACTA
CTGATTACACGGGGGAAGCTCTGCAACTTCTGGACAAGCGA