Description :
Non Conding Region
Location :
Scaffold_1:105382- 105552
Sequence
170 bases(100 bases per row)
AAGTTATGCGTGCGATCAAAACAGATATAAACGGCGAATATATGTGCATGTTTATATTGCTTCGAGTCTCGGCGAAGTGGTGGTCACTTGAAAACTTTCG
GAGCAAAAAGCTGGACCCACCAGCATTTAGCTGCGTTGGCCTAAAGTCATATCCATTGAGACCGCTAATT