Description :
Non Conding Region
Location :
Scaffold_1:105263- 105634
Sequence
371 bases(100 bases per row)
CAGGCTCTTGTTTACACTTAGTTTGATGCGGCAGGACGTACATACATGCATCCTACTACTAGTATGTAGTAGTACTTCTTGGCACCTACCTGACCAGTGA
ACCATCGCGTTTACAAGTGTCAACAGTATTATACTAACTTACAGTTATAGTACATGATTGGAAGGGTTAGCTACTAACTACTACCCACAACGACATTATG
CTGGTTTCCCATTGCGTTTTACTAGCCAACGTTATGGCCAAGCTAGAAACCCTCTGTAAATTACCGGTCAATGTCCATCATTTAGCGGGTAGGGTACAGT
ATTACTGTAAAAAGGGAAAGAAAGTCCCGTTGATGGATTGTGCAGTTTCGTCTATTTATAACTTATCCCAC