Description :
Non Conding Region
Location :
Scaffold_1:105009- 107067
Sequence
2058 bases(100 bases per row)
TCAAAGTAGTTGGAACTCGCGCGCCGACGGTATTCGCCCGCGCCGGGCGTTTGCATGCTCACGTACGATTGATTCTGCGCGCGCGACACCTCCATCTCGT
CGCAATGTTTTTTCTCTCTTTATTCTTTTCTCTGAAAAGCCGACGCTTCTTTACGCGCACAAGCAGTTACGACACACCCGTCGCAACGACAAACGAACGC
GCGCCCGTCAACCTACGCACACACGCACACACGTATGTTCACGCGCGGCTCGTCGAATGCGTCGTTAGTTAGCGCTCCTCTAAAAGCCCGCTTCTCCGTC
GCCCCAGCACGCAGTCGGGAAGGGGAAATGGGATGGAAACTGATCGCTTTCTTTGCTTTCCTCCTCGTCTTTCCTTGTGCGTGCCCTGGCTCGAGGGGGC
GTTCGTTGCAAGATGGGGGGAAACGCGGGTAGGGGAGCGCGAGGGAGAGACAGGAGATGCACTAGGACGAATATTCAGCCTTTGGATAACCCCTAGTCGC
TGCTCGCTGATTTTTAGCCAATCAAAATTTTAGAAAATGTTGTCCCACCAACAACATACATACAAAATGCCATTCAGGCATAATGCGCAAGAGAGAACCA
AGCAGCCATCTTTCGTGGAGGGGAACGAAACCCTGTATTTTTTTCTGGTTTTTCTTCTTTCTGCTCTTCGACACCAAAATGAGTTCTACTACTGTGTGTG
GTATATCTATGCATGTGTATGAAATTTCCACTGTTAATACAACCACACGGCTCCTCTCGAACTGTCCTTGTGTGCCGAGCAACAGCGTTCTTTTTGAAAA
GCCGCTGCTGCAAACTATAGTCTCGTACAAAGTCCAACAGCTCGATGACGACGAGACAGCTGGGAGCCAAAATATTTTCCTACGCCAGCGAAAAAACAGC
TACCCCTTCAAGTGGCAACCGCAAAAAAAAACCAGTTTCACTCTCTTGCGCACAAACGGCGCGGCAGCATCCCTCGTTTTAACGGCTGACGACGTTGCGT
AAAGCATGTCGTGGCCATACTAAATACTTAAAACTTGTGCTTCCAGCAGGAGTTGCAATAAATGCGACAGAGTTCTTCAAGCGAGGGGGCTTCTGTGGAC
GTCGACCTCGATTTGCGTTTTGTTTGTGTGAAGACAAAAAACTGAAGAAGCCCCTTCGCGGGTGTCTTCTTCATTTGCAGAGTGGTGGGGCGACTATTAT
TATAATAGCTCACCTGTAGACCTAAGATTCGCGTATATATATTTGCAAGTACGAGGCTGAATGGCTGCACAGTATGGAGCGCAGCCACAAAAAAAAAGGA
GTCGTCTGAGAGCATCCGTTTTCATTTTTTTCTCACAATGGCTCGCTGGATTTCCTTCACAATAATACCAAGAGACAGCGCTGCAAATGCCATGTGTGCA
TGTAGCCCATGTGGCTGGGTTTTGGATCTGCGTTCTTCTTCTTGGCTAGTCGACTCAGTGGCTGCTCGGCTGTTCGCGCTCGAAGTACCAGGCGCGCGGT
TTAAAGTGTGCGAATTCGTCAAAGACATATTTTTGCGTGACGAATAGAGCGGATGTAGCACGAAGGTACAAGCGATTACGATCACAATGACATGGTTGCA
ACGTCGTGGTGACTAAACCTGAACAAAAAAGGCGGCACTTTGTATCAGCTACATACATGACCGACACACACGGAAACGAGTGCTTTCGGTATCGTCACAG
TGGATCATGGCGTGCTATTAGAAGAGATCGCTGTATCATTGCATATCCCCTTCCGTAAGGAGCGCTGCAAATGCTTACAATAGTGCGCATGTCCCACTAT
GCATTGTCCTGCGTATCGTCCTACTTAGGACAAGTTTCTCCTACGTGTACTACCCAAAATCACTAAAACCACTATGATTGGCTAAAATAGTGTGGGGCGC
TCCACACTGCATTCGTACCAAAACACGGTGCCCTTCGCCCTGCCCTTGTGCCACTTGAAGGTACATGCGATTTAGTGGTGGAGACTTGGGCTCTTTTCCT
GTGCGCCAACGACCCACTCAGCGCCTCAAGCAAGGGGAAGAAGCACCACGCCAAGCAG