Description :
Non Conding Region
Location :
Scaffold_1:10490- 11510
Sequence
1020 bases(100 bases per row)
TTGAGCGTGGCTGCTGTCAAGTGAAAGGGTTTgcatgctgccgccgcagtATGGAGGATGGCGAAACTGCAGTGCTATGCGAGGGACATCGTAGGTGTGA
TGCATTGACATTGATAATAACAGTGGATGAGCAATGGTCCCCCTTTGCTGTCGTAGCAAAGTCCGTAGAACAAACGACAGGAAGTCTGACTGCTCCAGGT
CGACATGCAAGGCGGACGATCATGCTCTTTGCGCGAAGATATTATCTGACCTCAGGGTGTAACCGAAGGAAACAATGTTGCGGGCTACTCCGCCCGGTAC
TTGGGTATagccaagaagacggcaaGCGTACGCTGAAAAGACCGGTGGCATCATGGGCATGAGTCACAAATCGACTAACGTCACAGAATTGTCCTCGACG
GGGACGAAGATGACCCTGGTTCTGTTTGAAAATCgtctgcggcttcttggtTCTCTTCCAGCACTGTGCACGCTATCATCAACGTGTTGATTGGGGCCGA
acatgaagcagctccaaTTTCCATGACCAATCTTGAGGGCAGGCCATGTTCTTCACTCGGACGGCAGCTGACTTGAGCGTGTGCGTGCCTCAAATTGGTC
TCGGTCTAAAGCATGTCGCCGAGGATGCAGACTACGCGATGTCCGAGGGCCCCGTTTCGGGCCGTAACGTTACAATGATCCGTGGTCGCCAACCCCCTCT
TCACGTCTTCACGCTGCAAAACGGGAGACTATCTGTTTGGCACCCTGGATCTCGAGTAACAGAGCAAGCATGCACGCAATGTTGGCGAGTAGGGAGTGAG
TGGATGGTGCTAACCTCATTGGTAATTGGTTCAAGCTTGATACAATGGCGGGTGCGTTTGTGCAGTTCAAATTCGCAGGCACCATACCTATTGAAAAgag
cctccagcacctcgcaGGTCCGTCACACTGTTTCAGCTCTTGCGGCCTGCAAAATGAACGCACATGAAGTGGACAACTCAGTACCATAACGCTAATCAGA
ATGTCCCTCCAGCTTCCGCT