Description :
Non Conding Region
Location :
Scaffold_1:104696- 104871
Sequence
175 bases(100 bases per row)
GGGGGAGATCTTGACGGTGTAGACGAAGAAAGAAGCTTCAAGTTGTGCTGCCGAGCTATCAACAGTCATCTTGCGCAAAGTACGAAAAGCTCCATGGGGT
AGTCGCACGTAGTGGTAGATGGACGCGTGTATGGAGAATTCGAAGTTGCTTGAATAAATATTAACTACAAATACT