Description :
Non Conding Region
Location :
Scaffold_1:1046- 1409
Sequence
363 bases(100 bases per row)
TGGTCCGTCCGTTGGATGCAACGATTCACATAACCACGCGTTGATTCGAAGATGCCGGGGCTGGAATCGGACGAGAAGTGCTAAGCATGAAAAAAATGAT
GCTGTTagattaaaaaaaaaactataGGTAAAGAGCGCTTTTTAGATACTCGTTAGACATACCTTCACCCGTCTTATCACTTGTTGCGAGTTCGCCGCTC
CTCGTAAACTGCCTAAACAGCGAAGCATGCTCAACTTGCTCCTCTCGAGATAAAATACCGTACACACTCTTATTTATAATACCGTAATCCACAAAATAAT
TCACCACCATCACACATAATATTGTGTTCCAAACGCTTATTTTTTGGGTATCACTCTCGGCAA