Description :
Non Conding Region
Location :
Scaffold_1:104597- 105548
Sequence
951 bases(100 bases per row)
TCACAACTGAAGGAGATGGCTCTCCTAACGTGACACCTTGGGAGGCAGCGGTTGGTGTGGAGTTCATGTACAATACGAAAGGTGCACCTGAGTACGGTAC
TTCGGGATCCAAAGTCATGCGGGTTACGCGTGTGAGCCCCGTTAAAGCATTTTTGAACCAGATGACCGCCTTGCTTCGCAAGAGAGTACAATGCGGAAAG
CGTGACTTCAATATGCTGTTCTTCAGCACTATTCTCCCCATTGTCGCCATCTTTATCGGGCTGTCAGCACTAAAGTTTAGTACAGTGCTGGTAAATGACC
CTAAGCTGGAACTTTCCCCATCTGTGCAGTATTTACTCGCCAAGCACACACCAGTTCCGTTTAGCTGCCCAAGTAACCTCGGAAATAGTACTGCGTGGTG
CTCTGAGTTGGTTGAACCAGCGTACTTTTCAGATGGTACTGCGTACGAGATCGAGATTGATCCGACTGTGTATAACGCACTGACGACGCCTACAGTTTTC
GGGATAACCTATGATTCGCCTCCAATCGATCCGAGCGACACCAGTGGCTACAGCCTTCGGTTTGCGGAGCTTGTCTTCGAAAAGGGATACGGGTACACAT
CGAATTCAGATTTGGCTGGTCCTCCAACTGAGGCAGCTGTTGGGGGACAGTTTGGCGGCTATCTGTTGTATGCCTCAGAAACTACCAACACGCTAAGCTA
CAACATCCTAGCGAACTCATCATCCACACATGCTGCACCGACGTACAAGCACATGATGGACAGTGCTATTCATCGGTTTTTGCTTTCCAAAGCTTTGGGT
GTGCACGAACCGGGTCCAAACATGACAGTTCGAGTTTCCTCACACCCACTGCCGCTTTCTTTCAGGACGCGCTCCATCTTCAGCTCGTACCTGAGCTTCC
CTGCTGTCATTTTTATCGTGATTGCCTTTACGTTCATCCCAGCATCGATAA