Description :
Non Conding Region
Location :
Scaffold_1:104446- 104579
Sequence
133 bases(100 bases per row)
GGGTAACTCCAGTGCAGATAGTCTGATCGGACAAGGGTCGGCTAGACTCGAGTGACTTCGTGTTGGAAACACTTCTCTATTTGCCATCAAAATTCAACTT
GTCTTCTACCCAAAACTTGAGGTTCGTCTCTAT