Description :
Non Conding Region
Location :
Scaffold_1:10431- 10461
Sequence
30 bases(100 bases per row)
GGGAGTTCCGAGCAGTTAAGTCAGCAACGA