Description :
Non Conding Region
Location :
Scaffold_1:104206- 105549
Sequence
1343 bases(100 bases per row)
CACTAACTAGTATTTGGAACGAATAACACGATTTGCGAAACGATACAACGTGTTTTATGGTTTGTGGTATCAAACGCAAGTGTCCATAACCGTTTACGAT
TCTTTGGGGCAGGTTGCGGACGAGCGCATTGACATGCGACCACTCAAGCAGTCATGACCGCTCGCTGCGAGATGACTTGTAGCCTATCGACTGATGATTA
CTAGGGAGGCCACCTCGACAACGCCGGTGAGAAAAAACGTTGTTGGTGAGGGCAGGAGGCATGATTAATGCAAGGGTATACTGTATAATAAATAGAGGGT
AGGGGACTTATATACCCTTGATGAATGCGAGCAAGAGTAGAAACTTCCTACGTGTGCGCCACTTTGCTAGCAGAAGCCCGGGACACGAGCTTGGACCAAA
CCGGCGACCTGGTGCGGCCTGTGACATTGCTTTTTGCGGCCGAAGCGCCAACGCTTGGCAGGCTTCGTCCACCAGCACGATCCAAAATCAATCGACTACA
TTGCAATGCTCATATATGTAGTAGAAGCCCATGGTAGCAGCCACCACGTGCGACTTCTTACATGGGAATTCGGGAATTCATAAGAAAAAATGCTATCGAA
CCCCAAGTCGATGGCCTTAAGTCGATGCTGCCGCGGCGGGCTTTGAACCAAGTGGCATTTCCAGGCGCGTTCGAGTCGTCTCTCATTTCCGAGCTTGGCA
CATGTTTGGCAAAAAGTAGTTTTACTTGATTATTGTATGGCGACCGACCGCCAGACGTTGTGGCAAGGTTATCGTGTCACTGGCTCGTGCGTCTGAGCCA
CGCACTGGAGCCCAGCAACGCGACGAACTCAGTGGAACAAGAGACGACCAATGCCACTCGAGTGGCAGCGCGGTGTGGGATTTTGCATCATCATCGTCGG
CGCTGTGTGGGAGAATACTGCTAAAAAGTGGATCGGCGGGGCGTTCTCATTCGCACGGTTGGGGATCGATAACGCAGACGTGTCCAAATCAGATGTTGAC
GCACCAGTGCCAGATTAGTAGCTAGATCGATTGTGGTGCGTCCCACATTTGACCGCCTGGTTCCCACCGAGTTTGAATCTCCACCCACCATGCAACATTT
GGAGCCTTATGATCTGACATCAGACGGTCTTGCACCACATCCAGAAGCGTAGGTTATTCTTGACCACTTCTCTTGACAAGTGTTCTTCCAGATTAGTAGT
AAGTATCAGGAAATGGACTGGTCGTCCCACACTACTCGCTGCATCTTTCTGCTGCGCGGGAGACCGTCACTTGGGCCACACTGCCAGATACTGGAAATGT
GAAATGTCCACGCAGATAGCATGGTTCATTTACAGATTTCCTC